You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
deaD [2018-01-31 17:16:18]
Molecular weight
53.85 kDa
Product
DEAD-box RNA helicase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
4,015,987 → 4,017,426
The protein
Catalyzed reaction/ biological activity
RNA helicaseProtein family
Paralogous protein(s)
Domains
Helicase domain 1: AS 1-203Linker region: AS 204-212Helicase domain 2: AS 207-368RNA-binding domain: AS 404-479Structure
2G0C (RNA-binding domain, AA 404-479), 2HJV (second domain, AA 207-368); 3MOJ (RNA binding domain complexed with a fragment of 23S ribosomal RNA) PubMed Expression and Regulation
Biological materials
Mutant
MGNA-B720 (deaD::erm), available at the NBRP B. subtilis, JapanGP1052 (ΔdeaD::tet), available in Jörg Stülke's labBKE39110 (ΔdeaD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTATAAACTCCTGTCTC, downstream forward: _UP4_AAATGATGAATGACCTGCTCBKK39110 (ΔdeaD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTATAAACTCCTGTCTC, downstream forward: _UP4_AAATGATGAATGACCTGCTC Expression vector
for expression/ purification from B. subtilis with C-terminal Strep-tag, for SPINE, expression from the native chromomsomal site: GP1065 (spc), available in Jörg Stülke's lab Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab FLAG-tag construct
Labs working on this gene/protein
References
Loading